Materials and methods 2.1. Plant material, explant disinfection, and establishment Plant material and explant establishment were conducted with Euphorbia pulcherrima cv. Christmas Eve supplied by Selecta Klemm GmbH & Co KG. Young, disease‑free shoots (≈5 cm) were received as starting material. Leaves were removed, and the basal ends were freshly trimmed. To deplete endogenous latex, the shoots were held in water overnight. Surface sterilisation was performed in 1% (w/v) sodium hypochlorite containing 0.05% (v/v) Tween‑20 for 20 minutes, followed by three rinses in autoclaved double‑distilled water (DDW) for 5, 10, and 15 minutes, respectively. Excess moisture was blotted with sterile filter paper. Sterile shoots were cut into ≈1 cm nodal segments and 1–5 mm internode pieces for culture initiation (20 explants from each 5 cm shoot). For establishment, explants were placed on Murashige and Skoog (MS, 1962) basal salts supplemented with 2 mL L⁻¹ Plant Preservative Mixture (PPM) and 200 mg L⁻¹ cefotaxime, without plant growth regulators (PGRs). Nodal and internodal explants were maintained for two weeks, after which healthy, contaminant‑free material was selected for subsequent in vitro experiments. 2.2. Optimizing PGRs for direct organogenesis from internode explants To assess the influence of cytokinin type and dose on direct shoot organogenesis from internodes, healthy explants from the establishment phase were transferred to MS medium containing a fixed auxin level (0.1 mg L⁻¹ 1‑naphthaleneacetic acid, NAA) and one of three cytokinins—6‑benzylaminopurine (BAP), kinetin (Kin) or thidiazuron (TDZ)—each tested at 0, 0.5, 1.0 and 1.5 mg L⁻¹. In total, eleven media (including an MS‑only control) were evaluated in triplicate. After six weeks, morphological responses were quantified as regenerated shoot number (RSN), shoot regeneration percentage (SRP), developed shoot length (DSL) and yellow leaves number (YLN%). 2.3. Optimizing media formulations, myo-inositol, and silver nitrate for direct organogenesis The combined effects of silver nitrate (AgNO₃) and myo‑inositol were investigated using internode explants derived from the establishment stage. Two basal formulations were compared—MS with B5 vitamins and Driver & Kuniyuki (DKW; 1984)—while AgNO₃ was supplied at 0, 5, 10 or 20 mg L⁻¹ and myo‑inositol at 0, 0.5, 1 or 2 g L⁻¹ (see Table 1). Based on prior optimisation (Sections 2.2 and 3.1), all treatments contained 1.5 mg L⁻¹ BAP and 0.1 mg L⁻¹ NAA. Explants were monitored weekly for six weeks for direct shoot induction and subsequent shoot formation. Each treatment comprised three Petri dishes with five explants per dish, alongside two controls. At week six, RSN, SRP, DSL and YLN% were recorded for comparative analysis. Treatment Content Control without PGRs Control + PGRs without regeneration developers PGRs + 0.5 mg L-1 myo-inositol PGRs + 1 g L-1 myo-inositol PGRs + 2 g L-1 myo-inositol PGRs + 5 mg L-1 AgNO3 PGRs + 10 mg L-1 AgNO3 PGRs + 20 mg L-1 AgNO3 PGRs + 0.5 g L-1 myo-inositol + 5 mg L-1 AgNO3 PGRs + 0.5 g L-1 myo-inositol + 10 mg L-1 AgNO3 PGRs + 0.5 g L-1 myo-inositol + 20 mg L-1 AgNO3 PGRs + 1 g L-1 myo-inositol + 5 mg L-1 AgNO3 PGRs + 1 g L-1 myo-inositol + 10 mg L-1 AgNO3 PGRs + 1 g L-1 myo-inositol + 20 mg L-1 AgNO3 PGRs + 2 g L-1 myo-inositol + 5 mg L-1 AgNO3 PGRs + 2 g L-1 myo-inositol + 10 mg L-1 AgNO3 PGRs + 2 g L-1 myo-inositol + 20 mg L-1 AgNO3 Table 1. List of treatments for shoot direct organogenesis of E. pulcherrima cv. Christmas Eve using internode explants. PGRs are included in fixed concentrations of 1.5 mg L-1 BAP + 0.1 mg L-1 NAA in each treatment. 2.4. Elongation of qualified regenerated shoots Regenerated shoots deemed suitable from organogenesis or somatic embryogenesis were transferred to an elongation medium consisting of MS salts with 0.3 mg L⁻¹ BAP, 20 mg L⁻¹ AgNO₃, 200 mg L⁻¹ cefotaxime and 2 mL L⁻¹ PPM. 2.5. Rooting and hardening of elongated shoots For rooting, elongated shoots (≥1 cm) were placed on MS medium with B5 vitamins supplemented with 0.1 mg L⁻¹ NAA, 3% (w/v) sucrose, 0.65% (w/v) agar and 20 mg L⁻¹ AgNO₃. After approximately one month, a subset of rooted plantlets was acclimatised for subsequent in vitro work. 2.6. Assessing genetic fidelity via regeneration regulators and ethylene biosynthesis gene expression To evaluate genetic fidelity during direct organogenesis, young shoots regenerated after six weeks were randomly sampled for transcript analysis. Total RNA was isolated from 40–100 mg of finely ground plant material. Expression of seven genes was quantified: four shoot‑regeneration regulators— (SHOOT MERISTEMLESS, STM, Cyclin-dependent kinase encoding gene D-type, CYCD, WUSCHEL, WUS, and WOUND INDUCED DEDIFFERENTIATION, WIND1) — and three ethylene‑pathway genes — (1-aminocyclopropane-1-carboxylate synthase, ACS1, 1-aminocyclopropane-1-carboxylate oxidase 1, ACO1, ethylene-responsive transcription factor ERF061, ERF). Quantitative PCR (qPCR) was performed on a StepOnePlus system (Applied Biosystems, Germany) using SYBR™ Green PCR Master Mix (Applied Biosystems, Austria) according to the manufacturer’s instructions. qPCR analysis was performed using three biologically independent replicates. Each replicate represents a distinct pool of explants derived from separate cultured plates, ensuring that the variation captured reflects true biological variance. EpActin was used as a reference gene for normalisation. Relative expression was calculated following Pfaffl (2004) using the ΔΔCt (Livak) method. Two primer pairs were designed per target and reference gene; specificity was verified by Primer‑BLAST and PCR, and final primer sequences are listed in Table 2. cDNA quality and amplicon specificity were confirmed by melt‑curve analysis and gel electrophoresis. Primer name Primer sequence (5`-3`) Primer length (bp) qWUS-FW ACTGTCGAAGAGTAGCCGAG 20 qWUS-RV TTACATGTGCAGGCAAAGCAG 21 qWIND1-FW ACCAAACCCTGACTCCATTT 20 qWIND1-RV TACAGAGGAGTACGGAAGAGG 21 qSTM-FW GCAGTCTAAAGCAAGAACTTTCA 23 qSTM-RV GAGGGATAGGGCCATTTGTAG 21 qCYCD-FW CTCGTAAACTTCAAACTCG 19 qCYCD-RV CGTAAAGAGGCTGTGGAT 18 ACS1-1-FW AGGCAGTGGCAAATTTTATGGG 22 ACS1-1-RV CCTGGATAATATGGAGTAGGCACC 24 ACS1-2-FW CAGCTTTGCTTTGATTTGGTTG 22 ACS1-2-RV AATTGTGGCAATCCATGATAATC 23 ACO1-1-FW GCTCTTCCAGGATGACAAAGT 21 ACO1-1-RV GTTGGTCACCGAGGTTGATAA 21 ACO1-2-FW GGACTAAGAGCACACACTGATG 22 ACO1-2-RV AATGGAGTGACGCAAAGGAG 20 ERF1-FW TTTGGCTTGGCACGTTTG 18 ERF1-RV GGGAAATTAAGCCGAGCATTT 21 ERF2-FW AAGCTCTACCGAGGAGTTAGG 21 ERF2-RV GCCTCTTCGGCTGTATCAAA 20 ERF3-FW GCAGCTTGATCATAGGCTCTT 21 ERF3-RV GGAAATGGGCAGCTGAAATTAG 22 Table 2. List of primers designed for genetic fidelity evaluation of shoot regeneration and ethylene biosynthesis genes. 2.7. Culture and incubation conditions Unless stated otherwise, MS or DKW salts were solidified with 0.65% (w/v) agar and contained 3% (w/v) sucrose. Media pH was adjusted to 5.7–5.8 with 1 N NaOH or 1 N HCl prior to autoclaving (121 °C, 20 min). All media components, PGRs and chemicals were sourced from Duchefa. Sterilized petri dishes were used during the establishment stage and organogenesis experiments. For the elongation and rooting stage, sterilized polystyrene containers suited for plant tissue culture were used. Cultures were incubated at 25 ± 2 °C under a 16 h light / 8 h dark photoperiod at ~40 μmol m⁻² s⁻¹ provided by cool‑white fluorescent lamps. 2.8. Experimental design and statistical data analysis All organogenesis and embryogenesis experiments followed a completely randomised design (CRD) with defined treatments, replicates, and explants per Petri dish. Cultures were observed and subcultured every six weeks, and all measurements were recorded. For direct shoot organogenesis, RSN, SRP and DSL were assessed visually. In parallel, transcript levels of the selected shoot‑regeneration and ethylene‑biosynthesis genes were quantified. Data were analysed by one‑way ANOVA (SPSS v27), and means were separated using Duncan’s Multiple Range Test and confirmed by using Tukey's HSD at p ≤ 0.05. The shoot regeneration percentage (SRP) was computed as: SRP = (Explants that regenerated shoots (S))/(Total Explants cultured per replicate (N)) × 100